View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4956-Insertion-8 (Length: 317)
Name: NF4956-Insertion-8
Description: NF4956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4956-Insertion-8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 98 - 317
Target Start/End: Complemental strand, 34369655 - 34369436
Alignment:
| Q |
98 |
attacccatccctgattttgttgttcttgttcctattgccccttcgacctcccgtggagatacttattgatatcgtggagtccacaatccacaattttag |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
34369655 |
attacccatccctgattttgttgttcttgtacctattgccccttcgatctcccgtggagatacttactgaaatcgtggagtccacaatccacaattttag |
34369556 |
T |
|
| Q |
198 |
gactaatagaatagaaaaaggatagtgcgtgagctgtgactattctttgataccacaaatcaaagtttcgtctcaactctaaaaacataatctcctccca |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34369555 |
gactaatagaatagaaaaaggatagtgcgtgagctgtgactattctttgataccacaaatcaaagtttcgtctcaactctaaaaacatattctcctccca |
34369456 |
T |
|
| Q |
298 |
aaatttctctgtggtctgaa |
317 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
34369455 |
aaatttctctgtggtctgaa |
34369436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University