View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4957_high_18 (Length: 248)
Name: NF4957_high_18
Description: NF4957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4957_high_18 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 24 - 248
Target Start/End: Original strand, 41567253 - 41567477
Alignment:
| Q |
24 |
gcctttcgtctctctcacgccactgtcgctcctctcactttccccgcccgccgccaccattccaccgcttgcaacaacctccaaatctcaaccggcggtg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41567253 |
gcctttcgtctctctcacgccactgtcgctcctctcactttccccgcccgccgccaccattccaccgcttgcaacaacctccaaatctcaaccggcggtg |
41567352 |
T |
|
| Q |
124 |
gagctgcttcgatatggcacgcgattactccttgcggcggcgacggattccgaaccggcggtgtgatgcttcatcatgaccacgaactcaaaggtgaagg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41567353 |
gagctgcttcgatatggcacgcgattactccttgcggcggcgacggattccgaaccggcggtgtgatgcttcatcatgaccacgaactcaaaggtgaagg |
41567452 |
T |
|
| Q |
224 |
atcgtggaacgttgcttgggatgct |
248 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41567453 |
atcgtggaacgttgcttgggatgct |
41567477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University