View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4957_high_19 (Length: 247)

Name: NF4957_high_19
Description: NF4957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4957_high_19
NF4957_high_19
[»] chr4 (1 HSPs)
chr4 (49-225)||(51433585-51433761)


Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 49 - 225
Target Start/End: Original strand, 51433585 - 51433761
Alignment:
49 ataattttacttaacttttagcctaactctagattactaaagtataggattaaaatcaaaaatacatatatgatatgagttatgagagaattaccagtta 148  Q
    |||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
51433585 ataattttacttaactttaagccgaactctagattactaaagtataggattaaaaccaaaaatacatatatgatatgagttatgagagaattaccagtta 51433684  T
149 gcagcagagaaatgtttcacggactcttgatcactgatgatgttaatgtcaacattattgatactattagaagtagt 225  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||    
51433685 gcagcagagaaatgtttcacggactcttgatcactgatgctgttaatgtcaatattattgatactattagaagtagt 51433761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University