View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4957_high_19 (Length: 247)
Name: NF4957_high_19
Description: NF4957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4957_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 49 - 225
Target Start/End: Original strand, 51433585 - 51433761
Alignment:
| Q |
49 |
ataattttacttaacttttagcctaactctagattactaaagtataggattaaaatcaaaaatacatatatgatatgagttatgagagaattaccagtta |
148 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51433585 |
ataattttacttaactttaagccgaactctagattactaaagtataggattaaaaccaaaaatacatatatgatatgagttatgagagaattaccagtta |
51433684 |
T |
 |
| Q |
149 |
gcagcagagaaatgtttcacggactcttgatcactgatgatgttaatgtcaacattattgatactattagaagtagt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51433685 |
gcagcagagaaatgtttcacggactcttgatcactgatgctgttaatgtcaatattattgatactattagaagtagt |
51433761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University