View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4957_low_14 (Length: 255)
Name: NF4957_low_14
Description: NF4957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4957_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 41567465 - 41567701
Alignment:
| Q |
1 |
tgcttgggatgctcgtcctgctagatggcttcatcgttccgactccgcttggcttcttttcggtgtctgcgcttgccttgcgccgccggttgtgcttgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41567465 |
tgcttgggatgctcgtcctgctagatggcttcatcgttccgactccgcttggcttcttttcggtgtctgcgcttgccttgcgccgccggttgtgcttgac |
41567564 |
T |
|
| Q |
101 |
gttgatcccgaggcggcggcgccgactccagctgtttttccgaccgagagttccgagggacgtgaaatgaaagatgagctgtccgatgaacgtgacgatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41567565 |
gttgatcccgaggcggcggcgccgactccagctgtttttccgaacgagagttccgagggacgtgaaatgaaagatgagctgtccgatgaacgtgacgatg |
41567664 |
T |
|
| Q |
201 |
aactcaacgctgattacagagtcacgggttcgttttt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41567665 |
aactcaacgctgattacagagtcacgggttcgttttt |
41567701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University