View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4957_low_4 (Length: 455)
Name: NF4957_low_4
Description: NF4957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4957_low_4 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 382; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 382; E-Value: 0
Query Start/End: Original strand, 18 - 455
Target Start/End: Complemental strand, 6352757 - 6352321
Alignment:
| Q |
18 |
tgattctcgttcttgctggcttaatcagctcgatttttatgccgttgatcatcctaactagtcccatatggattccaaccgcgacacttttctttctctt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6352757 |
tgattctcgttcttgctggcttaatcagctcgatttttatgccattgatcatcctaactagtcccatatggattccaaccgcgacacttttctttctctt |
6352658 |
T |
|
| Q |
118 |
caccgccatgtttttgtctgcttgcggatttgttgttgctgtggtgactatcctttatcaggcttacagctactacatgcgacgccaaccgcaaagcaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6352657 |
caccgccatgtttttgtctgcttgcggatttgttgttgctgtggtgactatcctttatcaggcttacagctactacatgcgacgccacccgcaaagcaaa |
6352558 |
T |
|
| Q |
218 |
tgaagtagacctcaacatggttttaaattgcagtctatcaccgcaattaaagcctcgatttaannnnnnnnatatttctgtgttatttaaatcaacttct |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6352557 |
tgaagtagacctcaacatggttttaaattgcagtc-atgaccgcaattaaagcctcgatttaattttttttatatttctgtgttatttaaatcaacttct |
6352459 |
T |
|
| Q |
318 |
ttatcttcatgttgcttcttttaccaaaaatttgatgtcaatgtctaaatttgctaagaataatgcagtgtgtttgtgaaatcacacgccacaaagcaaa |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6352458 |
ttatcttcatgttgcttcttttaccaaaaatttgatgtcaatgtctaaatttgctaagaataatgcagtgtgtttgtgaaatcacacgcaacaaagcaag |
6352359 |
T |
|
| Q |
418 |
cactcgtggatccctaggtgcaatggcttgtatacttc |
455 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6352358 |
cgctcgtggatccctaggtgcaatggcttgtatacttc |
6352321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University