View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4958-Insertion-5 (Length: 344)
Name: NF4958-Insertion-5
Description: NF4958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4958-Insertion-5 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 8 - 344
Target Start/End: Original strand, 14539423 - 14539759
Alignment:
| Q |
8 |
ctctgctccttagtagtattggagcacggaaccaacgcgtccacagccatgccgttggaggcggctgtggcagctgcgatggctgcagcacgttgtgggt |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| || |||||||||| |
|
|
| T |
14539423 |
ctctgctccttagtagtattggagcagggaaccaacgcatccacagccatgccgttggaggcggctgtggcggctgcgatggctgccgctcgttgtgggt |
14539522 |
T |
|
| Q |
108 |
caagccatgggactaacatgtttccataaacaccaccacccgcgagaaagggtgattttccgcggtgcggaaagcttgtggcttggttcactatagactc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14539523 |
caagccatgggactaacatgtttccataaacaccaccaccggcgagaaagggtgattttccgcggtgcggaaagcttgtggcttggttcactatagactc |
14539622 |
T |
|
| Q |
208 |
caaggtaccactaccacgaggcttttcccatgtttccttcgaaggtgttgtacctgcggttgatggatgtttatgcggcactttcggtaaccctaagcca |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14539623 |
caaggtaccactaccacgaggcttttcccatgtttccttggaaggtgttgtacctgcggttgatggatgtttatgcggcactttcggtaaccctaagcca |
14539722 |
T |
|
| Q |
308 |
tgcatagaaatctgtccattttcccatgtcaattctg |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14539723 |
tgcatagaaatctgtccattttcccatgtcaattctg |
14539759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University