View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4962_low_2 (Length: 296)
Name: NF4962_low_2
Description: NF4962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4962_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 18 - 289
Target Start/End: Original strand, 25413360 - 25413649
Alignment:
| Q |
18 |
aatcatattatgtcataggtttttaatcgattgcgagtatttatattgctgccaa-------gaaagcattgtcaatgcg------------gttgttat |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |||||||| |
|
|
| T |
25413360 |
aatcatattatgtcataggtttttaatcgattgcgagtatttatattgctgccaaatgcggagaaagcatggtcaatgcggtcaaaattgcggttgttat |
25413459 |
T |
 |
| Q |
99 |
gtcgttgtagataccttaaaatcttttatgttgatgccataatttgtgattgtcgtttgcaatttgaaactacgaatatagtttagcgacatcgtttgca |
198 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25413460 |
gtcgttgtagatacattaaaaaaatttatgttgatgccataacttgtggttgtcgtttgcaatttgaaactacgaatatagtttagcgacatcgtttgca |
25413559 |
T |
 |
| Q |
199 |
attacagttaaacgccaccgatgagacctaaattgtcgttgccttgcaatctgtagagacataaaaaactttgatgtcggcaaccattgca |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
25413560 |
attacagttaaacgccaccgatgagacctaaattgtggttgccttgcaatctgtagagacataaaaaacattgatgtc-gcaaccattgca |
25413649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University