View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4963-Insertion-11 (Length: 211)
Name: NF4963-Insertion-11
Description: NF4963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4963-Insertion-11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 8 - 209
Target Start/End: Complemental strand, 31956243 - 31956035
Alignment:
| Q |
8 |
attttagcatttgaattaagtggtattttnnnnnnntgtaagaagtgaacatttctataataatgaaagaaggactcaccag--------agcatgagag |
99 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| ||||||| || ||||||| |
|
|
| T |
31956243 |
attttagcatttgaattaagtt-tattttaaaaaaatgtaagaagtgaacatttctataataatgaaagaaggattcaccaggcaagaagagtatgagag |
31956145 |
T |
|
| Q |
100 |
gagaattgtcccactgtgaactgcactccaacggcgaaaaccaccgtggcggtccaccgtccgcttcaatcaactttttcgcttgctcaaagtattcttc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31956144 |
gagaattgtcccactgtgaactgcactccaacggcgaaaaccaccgtggcggtccaccgtcctcttcaatcaactctttcgcttgctcaaagtattcttc |
31956045 |
T |
|
| Q |
200 |
ccaaccgctc |
209 |
Q |
| |
|
|||||||||| |
|
|
| T |
31956044 |
ccaaccgctc |
31956035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 88 - 209
Target Start/End: Complemental strand, 31941925 - 31941804
Alignment:
| Q |
88 |
agagcatgagaggagaattgtcccactgtgaactgcactccaacggcgaaaaccaccgtggcggtccaccgtccgcttcaatcaactttttcgcttgctc |
187 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |||||| |||| | ||| ||||||| |||||||||||| |
|
|
| T |
31941925 |
agagcatgagaggagaattatcccactgtgaactgcactccaacggcgaaaaccaccgcggaggtccatcgtctgtttcgatcaactctttcgcttgctc |
31941826 |
T |
|
| Q |
188 |
aaagtattcttcccaaccgctc |
209 |
Q |
| |
|
||||||||| | |||||||||| |
|
|
| T |
31941825 |
aaagtattccttccaaccgctc |
31941804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 88 - 160
Target Start/End: Complemental strand, 31968035 - 31967963
Alignment:
| Q |
88 |
agagcatgagaggagaattgtcccactgtgaactgcactccaacggcgaaaaccaccgtggcggtccaccgtc |
160 |
Q |
| |
|
||||||| ||||||||||| ||| || | |||| |||||| |||||||||||||||| || ||||||||||| |
|
|
| T |
31968035 |
agagcataagaggagaattatccaaccgcgaaccacactccgacggcgaaaaccaccgcggaggtccaccgtc |
31967963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University