View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4963-Insertion-15 (Length: 75)
Name: NF4963-Insertion-15
Description: NF4963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4963-Insertion-15 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 2e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 7 - 75
Target Start/End: Complemental strand, 46600375 - 46600311
Alignment:
| Q |
7 |
acctatacctagctcttcttaatttggtttatgtgacctagctaggttactctaatttatatattgatc |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46600375 |
acctatacctagctcttcttaatttggtttatgtgac----ctaggttactctaatttatatattgatc |
46600311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University