View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4963_high_16 (Length: 246)
Name: NF4963_high_16
Description: NF4963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4963_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 34422835 - 34423062
Alignment:
| Q |
1 |
gattcctcttattatgttattatctgtagcattgtttaatgctattttatgtcatgcgtatannnnnnnaactgttgtgttaaatagcgttgtcaaacta |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34422835 |
gattcctattattatgttattatctgtagcattgtttaatgctattttatgtcatgcgtatactcccccaactgttgtgttaaatagcgttgtcaaacta |
34422934 |
T |
|
| Q |
101 |
atctaacctcaaatttctgtcattgtatatcgtggaacatctatataaaagagttctgtgtctttttt-acgaagaaaggaaaaactgaaaaaatcagtt |
199 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
34422935 |
atctaacctcaactttctgtcattgtatatcgtggaacatctatataaaagagttttgtgtcttttttaacgaagaaaggaaaaactgaaaaaattagtt |
34423034 |
T |
|
| Q |
200 |
acttcgaggttctgttcattaatgattt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
34423035 |
acttcgaggttctgttcattaatgattt |
34423062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University