View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4963_high_18 (Length: 240)
Name: NF4963_high_18
Description: NF4963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4963_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 99 - 224
Target Start/End: Original strand, 31805301 - 31805426
Alignment:
| Q |
99 |
aaaggcaatattaattcataatcatttctatttagtactagatatgtaaccaaatatatgataatcaatatgtaatagatatgtaacggacgtaaaaaat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31805301 |
aaaggcaatattaattcataatcatttctatttagtactagatatgtaaccaaatatatgataatcaatatgtaatagacatgtaacggacgtaaaaaat |
31805400 |
T |
|
| Q |
199 |
tatttggttgaatgtcaagaagagaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
31805401 |
tatttggttgaatgtcaagaagagaa |
31805426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University