View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4963_high_21 (Length: 208)
Name: NF4963_high_21
Description: NF4963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4963_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 16 - 192
Target Start/End: Original strand, 2868553 - 2868723
Alignment:
| Q |
16 |
attattcttgcaattttgctctatattcaacaaagattgggctattacaagctgagtcaggttctgacatttgggcagtataagcttcttcctactttta |
115 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2868553 |
attattcttgcaattttggtctatattcaacaaagattgggctatgacaagctgagtcaggttctgacatttgggcagtataagcttcttcctactttta |
2868652 |
T |
 |
| Q |
116 |
gatatgaatatgaaaggttggattctaagtcctttgaaactgaactagttccaggtatcaatggtggtggtgaaaat |
192 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2868653 |
g------atatgaaaggttggattctaagtcctttgaaactgaactagttccaggtagcaatggtggtggtgaaaat |
2868723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 192
Target Start/End: Complemental strand, 25857176 - 25857008
Alignment:
| Q |
18 |
tattcttgcaattttgctctatattcaacaaagattgggctattacaagctgagtcaggttctgacatttgggcagtataagcttcttcctacttttaga |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25857176 |
tattcttgcaattttggtctatattcaacaaagattgggctattacaagctgagtcaggttctgacatttgggcagtataagcttcttcctacttttaga |
25857077 |
T |
 |
| Q |
118 |
tatgaatatgaaaggttggattctaagtcctttgaaactgaactagttccaggtatcaatggtggtggtgaaaat |
192 |
Q |
| |
|
|| |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25857076 |
ta------tgaaaggttgaattctaagtcctttgaaactgaacaagttccaggtatcaatggtggtggtgaaaat |
25857008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University