View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4963_low_10 (Length: 330)
Name: NF4963_low_10
Description: NF4963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4963_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 201 - 268
Target Start/End: Complemental strand, 5827634 - 5827567
Alignment:
| Q |
201 |
tatgtttatacgttgaattgattattgagcctccatggagtttgatccagcaatagccctattcatat |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5827634 |
tatgtttatacgttgaattgattattgagcctccatggagtttgatccagcaatagccctattcatat |
5827567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 101 - 179
Target Start/End: Complemental strand, 5828063 - 5827984
Alignment:
| Q |
101 |
tcgtggaggcttttggactttggaa-gctgcaaaatttggcaaggaatatgtattttagttgtattcgttattcatgaat |
179 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5828063 |
tcgtggaggcgtttggactttggaaagctgcaaaatttggcaaggaatatgtattttagttgtattcgttatccatgaat |
5827984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 5828163 - 5828105
Alignment:
| Q |
1 |
tgaaatggaagtggtaaaagtaaaataaattcctcgtttctaatggacttatggaggcg |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5828163 |
tgaaatggaagtggtaaaagtaaaataaattcctcgtttctaatggacttatggaggcg |
5828105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 258 - 313
Target Start/End: Complemental strand, 5826670 - 5826615
Alignment:
| Q |
258 |
cctattcatatactcagtggtcgagctagctcaattttcatgaggatgtcaaatat |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5826670 |
cctattcatatactcagtggtcgagctagctcaattttcaggaggatgtcaaatat |
5826615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University