View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4963_low_15 (Length: 255)
Name: NF4963_low_15
Description: NF4963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4963_low_15 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 17 - 255
Target Start/End: Original strand, 14166519 - 14166758
Alignment:
| Q |
17 |
tgatcagaaaatgtaaagtt-aaatcattgtagtaacaatattttgtggacatggtaaagcattttataacgagagtgtatcaaaattaaactctagaag |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14166519 |
tgatcagaaaatgtaaagttcaaatcattgtagtaacaatattttgtggacatggtaaagcattttataacgagagtgtatcaaaattaaactctagaag |
14166618 |
T |
 |
| Q |
116 |
aacattttatgaatggttccgatttgttttcaatgtacaacttttacctagacaatgtagcaaaattaaattcatcgcagaaaaatgtgagagatctacc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14166619 |
aacattttatgaatggttccgatttgttttcaatgtacaacttttacctagacaatgtatcaaaattaaattcatcgcagaaaaatgtgagagatctacc |
14166718 |
T |
 |
| Q |
216 |
ttttcatagtacttaacatgatcattgaagctacggatgg |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14166719 |
ttttcatagtacttaacatgatcattgaagctacggatgg |
14166758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 79 - 112
Target Start/End: Original strand, 11189277 - 11189310
Alignment:
| Q |
79 |
tttataacgagagtgtatcaaaattaaactctag |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
11189277 |
tttataccgagagtgtatcaaaattaaactctag |
11189310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University