View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4963_low_17 (Length: 242)
Name: NF4963_low_17
Description: NF4963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4963_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 14166802 - 14167027
Alignment:
| Q |
1 |
cagcttctgtaaagattaaacggacacaaatttaaataacgagttataatatcataannnnnnnaatatcgtaatctttttattatataccttagtgatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14166802 |
cagcttctgtaaagattaaacggacacaaatttaaataacgaatcataatatcataatttttttaatatcgtaatctttttattatataccttagtgatg |
14166901 |
T |
|
| Q |
101 |
gaagtaccatgagtctctctgtagcggttgaatgtcgcaatcagctgggttttgctccttgtagtcaagatcctaatggcttcttcatgacttcctttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
14166902 |
gaagtaccatgagtctctctgtagcggttgaatgtcgcaatcagctgggttttgctccttgtagtcaagatccttatggcttcttcatggcttcctttct |
14167001 |
T |
|
| Q |
201 |
tctctttcactgactcatgaagaatt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
14167002 |
tctctttcactgactcatgaagaatt |
14167027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 116 - 225
Target Start/End: Original strand, 14173880 - 14173989
Alignment:
| Q |
116 |
tctctgtagcggttgaatgtcgcaatcagctgggttttgctccttgtagtcaagatcctaatggcttcttcatgacttcctttcttctctttcactgact |
215 |
Q |
| |
|
||||||||||||||||| || || | ||||| || |||||||||||||| | ||| |||||||||||||||||| ||||||| |||||||| | ||| | |
|
|
| T |
14173880 |
tctctgtagcggttgaaagttgccaaaagctgagtcttgctccttgtagtaaggattctaatggcttcttcatgatttccttttttctctttgattgatt |
14173979 |
T |
|
| Q |
216 |
catgaagaat |
225 |
Q |
| |
|
|||||||||| |
|
|
| T |
14173980 |
catgaagaat |
14173989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University