View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4963_low_18 (Length: 240)

Name: NF4963_low_18
Description: NF4963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4963_low_18
NF4963_low_18
[»] chr2 (1 HSPs)
chr2 (99-224)||(31805301-31805426)


Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 99 - 224
Target Start/End: Original strand, 31805301 - 31805426
Alignment:
99 aaaggcaatattaattcataatcatttctatttagtactagatatgtaaccaaatatatgataatcaatatgtaatagatatgtaacggacgtaaaaaat 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
31805301 aaaggcaatattaattcataatcatttctatttagtactagatatgtaaccaaatatatgataatcaatatgtaatagacatgtaacggacgtaaaaaat 31805400  T
199 tatttggttgaatgtcaagaagagaa 224  Q
    ||||||||||||||||||||||||||    
31805401 tatttggttgaatgtcaagaagagaa 31805426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University