View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4963_low_19 (Length: 237)
Name: NF4963_low_19
Description: NF4963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4963_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 143 - 226
Target Start/End: Complemental strand, 48011132 - 48011049
Alignment:
| Q |
143 |
taatgtcacattgttaaatgtttatatttttatcagaaaacaagaaatggaaatagactgtagtaacggaaactatgtaggcct |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48011132 |
taatgtcacattgttaaatgtttatatttttatcagaaaacaagaaatggaaatagactgtagtaacggaaactatgtaggcct |
48011049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 17 - 95
Target Start/End: Complemental strand, 48011258 - 48011180
Alignment:
| Q |
17 |
aaacaagatatctaatgcatcaaaaaatttctgcattatttcccggcacatatctgctaggagtttaaagatttgtgat |
95 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48011258 |
aaacaagatatctaatacatcaaaaaatttctgcattatttcccggcacatatctgctaggagtttaaagatttgtgat |
48011180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University