View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4964_high_9 (Length: 310)
Name: NF4964_high_9
Description: NF4964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4964_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 29405152 - 29404860
Alignment:
| Q |
1 |
gacacgttggtggaattcttgcgtgatagttgtggtcgtagatttcctccgccagaattctcaggggaatctgccgtgaaccgagttgagctcccacgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29405152 |
gacacgttggtggaattcttgcgtgatagttgtggtcgtagatttcctccgccagaattctcagaggaatctgccgtgaaccgagttgagctcccacgag |
29405053 |
T |
 |
| Q |
101 |
tgaattttggcctgctagctggagcattggattcatctgatggatcgaggtcatctacttggtgtgttgacatgtctgagtcgtaatgagtttggactcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29405052 |
tgaattttggcctgctagctggagcattggattcatctgatggatcgagctcatctacttggtgtgttgacatgtctgagtcgtaatgagtttggactcg |
29404953 |
T |
 |
| Q |
201 |
aactgaattgcgacgaccgaattgtgaaaagcttctgctgtttggattttggatagggatgtctgacgttggaatgggaattgatgatgtcca |
293 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
29404952 |
aactgagttgcgacgaccgaattgtgaaaagcttctgctgtttggattttggatagggatgtcggatgttggaatgggaattgatgatgtcca |
29404860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 166 - 293
Target Start/End: Original strand, 19911822 - 19911952
Alignment:
| Q |
166 |
gttgacatgtctgagtc---gtaatgagtttggactcgaactgaattgcgacgaccgaattgtgaaaagcttctgctgtttggattttggatagggatgt |
262 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||| ||||| ||||||||||||||||| ||||| ||||| || || |||||||||||||| || | |
|
|
| T |
19911822 |
gttgacatgtctgagtcatcgtggtgagtttggattcggactgagttgcgacgaccgaattgagaaaaacttctactattaggattttggataggaatat |
19911921 |
T |
 |
| Q |
263 |
ctgacgttggaatgggaattgatgatgtcca |
293 |
Q |
| |
|
|||| |||||||| |||| | ||||||||| |
|
|
| T |
19911922 |
ctgaagttggaatatgaatcgttgatgtcca |
19911952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University