View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4965_high_13 (Length: 356)
Name: NF4965_high_13
Description: NF4965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4965_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 25 - 339
Target Start/End: Original strand, 34387491 - 34387805
Alignment:
| Q |
25 |
gaaaatcttccaacggcaaaccctccacccggtaacctccaaattgtcaacccaacattctcgtcttcattcgaattggaaatttcattgttaatttgtg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34387491 |
gaaaatcttccaacggcaaaccctccacccggtaacctccaaattgtcaacccaacattctcgtcttcattcgaattggaaatttcattgttaatttgtg |
34387590 |
T |
|
| Q |
125 |
gtgattcacaaggcaattcatgtcgacaaacgggacaagaattttgaattgcaagccatggaagtatgcattcattatggtatatgtgtttgcatggcat |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34387591 |
gtgattcacaaggcaattcatgtcgacaaacgggacaagaattttgaattgcaagccatggaagtatgcattcattatggtatatgtgtttgcatggcat |
34387690 |
T |
|
| Q |
225 |
ttcactagctgaaattccaagttcaaaaggctctttacaaacggcacaatgtgattctacattcatatgactctcgttgatttcaatcgtcggtaacaat |
324 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34387691 |
ttccctagctgaaattccaagttcaaaaggctctttacaaacggcacaatgtgattctacattcatatgactctcgttgatttcaatcgtcggtaacaat |
34387790 |
T |
|
| Q |
325 |
tccaccgcggatttt |
339 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34387791 |
tccaccgcggatttt |
34387805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 80
Target Start/End: Original strand, 41697403 - 41697456
Alignment:
| Q |
27 |
aaatcttccaacggcaaaccctccacccggtaacctccaaattgtcaacccaac |
80 |
Q |
| |
|
|||||||||||| ||||| || || |||||||||||||| |||||||| ||||| |
|
|
| T |
41697403 |
aaatcttccaacagcaaatccacctcccggtaacctccatattgtcaatccaac |
41697456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University