View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4965_high_29 (Length: 202)
Name: NF4965_high_29
Description: NF4965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4965_high_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 19 - 187
Target Start/End: Complemental strand, 43666106 - 43665938
Alignment:
| Q |
19 |
cctacagctttcacttttaactccctatgttcagttactcggtatcccccatacttgggccgcgtacatatggctctgcggcccaatctcggggatgctt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43666106 |
cctacagctttcacttttaactccctatgttcagttactcggtatcccccatacttgggccgcatacatctggctctgcggcccaatctcggggatgctt |
43666007 |
T |
|
| Q |
119 |
gtccaacctattgtcggttatcacagcgatcgttgcacttcacgcttcggtcgccgtcgtcctttcatc |
187 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43666006 |
gtccaaccgattgtcggttatcacagtgatcgttgcacttcacgcttcggtcgccgtcgtccgttcatc |
43665938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University