View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4965_low_12 (Length: 403)
Name: NF4965_low_12
Description: NF4965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4965_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 21 - 394
Target Start/End: Complemental strand, 693234 - 692863
Alignment:
| Q |
21 |
aacggttatgtctttgttaacaaaaacagagagatctgagaagaaagagaatgtggcgggtactatgttatctcattcattttcgggggatttaagggat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
693234 |
aacggttatgtctttgttaacaaaaacagagagatctgagaagaaagagaatgtggcgagtactatgttatctcattcattttcggggaatttaaggtat |
693135 |
T |
 |
| Q |
121 |
ccaagaaagagaagctgtgttttaagttgtccttcttcgatgagatcttcaccaagtcattctggtgttctttcacaaaagggtgttcttcttcgtggtg |
220 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
693134 |
tcaagaaagagaagctgtgtttcaagttgtccttcttcgatgagatcttcaccaagtcattctggtgttctttcacaaaagggtgttcttcttcgtggtg |
693035 |
T |
 |
| Q |
221 |
atcgagatgcttcttccatggaagagttgcagagtgctattcaaggtgctattactcattgcaaaaactctttgattacgaataaacatggggttagtag |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
693034 |
atcgagatgcttcttccatggaagagttgcagagtgctattcaaggtgctattactcattgcaaaaactctttgattacgaataaacatggggttagtag |
692935 |
T |
 |
| Q |
321 |
taatcatgaaattaatctcatctaactgttttgtaatttgttcaattggtgtttcatttactctttagtataat |
394 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
692934 |
taatcatgaaattaatctcatctaactg--ttgtaatttgttcaattggtgtttcatttactctttagtataat |
692863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University