View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4965_low_27 (Length: 220)
Name: NF4965_low_27
Description: NF4965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4965_low_27 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 44802108 - 44801889
Alignment:
| Q |
1 |
attatcttacaaagttaaccgccattgatacttggttgcaaatatcaccaagaccaggtgcccagccttatcctgaacttcattctgatgcttcgccaag |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44802108 |
attatcttaaaaagttaaccgccattgatacttggttgcaaatatcacgaagaccaggtgcccagccttatcctgaacttcattctgatgcttcgccaag |
44802009 |
T |
|
| Q |
101 |
ctctttcatccatttgatatacaaatcacttcacttataaattgctcaacacctacaccttcattataaaacttcttactcaaattcataccccatcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44802008 |
ctctttcatccatttgatatacaaatcacttcacttataaattgctcaacacctacaccttcattataaaacttcttactcaaattcataccccatcaaa |
44801909 |
T |
|
| Q |
201 |
tcactttcaaatatgtgtta |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44801908 |
tcactttcaaatatgtgtta |
44801889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University