View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4965_low_28 (Length: 218)
Name: NF4965_low_28
Description: NF4965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4965_low_28 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 208
Target Start/End: Original strand, 6545241 - 6545432
Alignment:
| Q |
17 |
agatactcatcgtccggcctaccaaacttcatgcagttttgttcatctatcatccatttgcatgtttcattgttatagtaaggtccttcagaatgaggaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
6545241 |
agatactcatcgtccggcctaccaaacttcatgcagttttgttcatctatcatccatttgcatgtttcattgttgtaataaggtccttcagaatgaggaa |
6545340 |
T |
 |
| Q |
117 |
tccaactacctgaaaagatgtcacatccttttgtatgtgttttgttgttcatgtgtttgacagaagacatgtttggtgatggttcatctgtg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
6545341 |
tccaactacctgaaaagatgtcacatccttttgtatgtgttttgttattcatgtgttggacagaagacatgtttggagatggttcatctgtg |
6545432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University