View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4965_low_30 (Length: 202)

Name: NF4965_low_30
Description: NF4965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4965_low_30
NF4965_low_30
[»] chr1 (1 HSPs)
chr1 (19-187)||(43665938-43666106)


Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 19 - 187
Target Start/End: Complemental strand, 43666106 - 43665938
Alignment:
19 cctacagctttcacttttaactccctatgttcagttactcggtatcccccatacttgggccgcgtacatatggctctgcggcccaatctcggggatgctt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||    
43666106 cctacagctttcacttttaactccctatgttcagttactcggtatcccccatacttgggccgcatacatctggctctgcggcccaatctcggggatgctt 43666007  T
119 gtccaacctattgtcggttatcacagcgatcgttgcacttcacgcttcggtcgccgtcgtcctttcatc 187  Q
    |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||    
43666006 gtccaaccgattgtcggttatcacagtgatcgttgcacttcacgcttcggtcgccgtcgtccgttcatc 43665938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University