View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4966-Insertion-11 (Length: 156)
Name: NF4966-Insertion-11
Description: NF4966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4966-Insertion-11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 9e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 9e-56
Query Start/End: Original strand, 8 - 138
Target Start/End: Complemental strand, 1251773 - 1251647
Alignment:
| Q |
8 |
ctctaagactgtatggagcataaaaggactacattcacatcattctttacgtttaatttgaagaaaatatgtcatcctccatacttaactacaactacat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1251773 |
ctctaagactgtatggagcataaaaggactacattcacatcgttctttacgttt----tgaagaaaatatgtcatcctccatacttaactacaactacat |
1251678 |
T |
|
| Q |
108 |
atcatgttacctttaagttttatgctcaaat |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1251677 |
atcatgttacctttaagttttatgctcaaat |
1251647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 17 - 48
Target Start/End: Original strand, 35889278 - 35889309
Alignment:
| Q |
17 |
tgtatggagcataaaaggactacattcacatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35889278 |
tgtatggagcataaaaggactacattcacatc |
35889309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 20 - 109
Target Start/End: Complemental strand, 4169754 - 4169669
Alignment:
| Q |
20 |
atggagcataaaaggactac-attcacatcattctttacgtttaatttgaagaaaatatgtcatcctccatacttaactacaactacatat |
109 |
Q |
| |
|
|||||||||||||||||| | |||||||| |||||| |||||| ||||||||| |||||| || ||||||||||| ||||||||||| |
|
|
| T |
4169754 |
atggagcataaaaggactgccattcacattattctt-acgttt----tgaagaaaacctgtcattcttcatacttaactgcaactacatat |
4169669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University