View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4966-Insertion-12 (Length: 96)
Name: NF4966-Insertion-12
Description: NF4966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4966-Insertion-12 |
 | |
|
| [»] scaffold0281 (1 HSPs) |
| | |
|
| [»] scaffold1843 (1 HSPs) |
| | |
|
| [»] scaffold0050 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0281 (Bit Score: 67; Significance: 2e-30; HSPs: 1)
Name: scaffold0281
Description:
Target: scaffold0281; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 8 - 78
Target Start/End: Original strand, 12563 - 12633
Alignment:
| Q |
8 |
gttctgttgttttttactgtgatttctaatgttgccattttcttattcatatttttctctttgaaattaac |
78 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12563 |
gttctgttgttttttattgtgatttctaatgttgccattttcttattcatatttttctctttgaaattaac |
12633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1843 (Bit Score: 63; Significance: 6e-28; HSPs: 1)
Name: scaffold1843
Description:
Target: scaffold1843; HSP #1
Raw Score: 63; E-Value: 6e-28
Query Start/End: Original strand, 8 - 78
Target Start/End: Original strand, 272 - 342
Alignment:
| Q |
8 |
gttctgttgttttttactgtgatttctaatgttgccattttcttattcatatttttctctttgaaattaac |
78 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
272 |
gttctgttgttttttattgtgatttctaatgttgccattttcttattcatatttttctctttgtaattaac |
342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 63; Significance: 6e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 6e-28
Query Start/End: Original strand, 8 - 78
Target Start/End: Complemental strand, 12729676 - 12729606
Alignment:
| Q |
8 |
gttctgttgttttttactgtgatttctaatgttgccattttcttattcatatttttctctttgaaattaac |
78 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12729676 |
gttctgttgttttttattgtgatttctaatgttgccattttcttattcatatttttctctttgtaattaac |
12729606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 55; Significance: 3e-23; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 12 - 78
Target Start/End: Complemental strand, 6836 - 6770
Alignment:
| Q |
12 |
tgttgttttttactgtgatttctaatgttgccattttcttattcatatttttctctttgaaattaac |
78 |
Q |
| |
|
|||||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6836 |
tgttgttttttattgtgattacttatgttgccattttcttattcatatttttctctttgaaattaac |
6770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University