View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4966-Insertion-6 (Length: 354)
Name: NF4966-Insertion-6
Description: NF4966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4966-Insertion-6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 3 - 354
Target Start/End: Original strand, 41034741 - 41035092
Alignment:
| Q |
3 |
caacaaaaggttcacggagccaaccatatcaagcaatgctggattagttgcagcattgattgcacttcaagacccttctaataattcacatgacttgaaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41034741 |
caacaaaaggttcacggagccaaccatatcaagcaatgctggattagtttcagcattgattgcacttcaagacccttctaataattcacatgacttgaaa |
41034840 |
T |
 |
| Q |
103 |
aactcattgtgggaatggatttgatttattattgaaagtcttgcatcaaatttctcttagtggaacagaattgtgaggatatgtgtaggaaaaaagggaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41034841 |
aactcattgtgggaatggatttgatttattattgaaagtcttgcatcaaatttctcttagtggaacagaattgtgaggatatgtgtaggaaaaaagggaa |
41034940 |
T |
 |
| Q |
203 |
gtgtgacaactataattatagcaaatatatttcattggctcatatcatcaacaatttgatggatttaatttttaaatggtacttttcatgtcatcaattg |
302 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41034941 |
gtgtgacaactataattatagcagatatatttcattggctcatatgatcaacaatttgatggatttaatttttaaatggtacttttcatgtcatcaattg |
41035040 |
T |
 |
| Q |
303 |
taaagttcagttatttcaggattttgatgcaatgaaggcatgattgttcaat |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41035041 |
taaagttcagttatttcaggattttgatgcaatgaaggcatgattgttcaat |
41035092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University