View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4966-Insertion-7 (Length: 317)
Name: NF4966-Insertion-7
Description: NF4966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4966-Insertion-7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 8 - 317
Target Start/End: Original strand, 42790972 - 42791281
Alignment:
| Q |
8 |
gaagaagaaggtagaaagtgcatttgacaagataagctagcacatgcaccttgttttgctttggcagcgttatgggcagcaagaacatcatgtttgatag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42790972 |
gaagaagaaggtagaaagtgcatttgacaagataagctagcacatgtaccttgttttgctttggcagcgttatgggcagcaagaagatcatgtttgatag |
42791071 |
T |
 |
| Q |
108 |
ttgttatatggctctggacaacaagcatcatgtcgttgaaattcggcacagtttcggtacctacatttgttgtgtttcgagcagcagaggcaccatcaac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42791072 |
ttgttatatggctctggacaacaagcatcatgtcgttgaaattcggcacagtttcggtacctacatttgttgtgtttcgagcagcagaggcaccatcaac |
42791171 |
T |
 |
| Q |
208 |
ggtgttgttttgacgcggcatagtggcagggatagagtcctgcagccaacggtcagttgcagcattacctatcctttgtgaagcggggttgagatagaca |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42791172 |
agtgttgttttgacgcggcatagtggcagggatagggtcctgcagccaacggttagttgcagcattacctatcctttgtgaagcggggttgagatagaca |
42791271 |
T |
 |
| Q |
308 |
cctcagtttc |
317 |
Q |
| |
|
||| |||||| |
|
|
| T |
42791272 |
ccttagtttc |
42791281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University