View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4966-Insertion-8 (Length: 205)
Name: NF4966-Insertion-8
Description: NF4966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4966-Insertion-8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 8 - 204
Target Start/End: Original strand, 54456853 - 54457049
Alignment:
| Q |
8 |
cttgcaatggagggggcgtttggaactatgcagaagcctctcaattctgtgtggtcaaattctacaccgatgatgatgatgaaccctgttgctgttgatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54456853 |
cttgcaatggagggggcgtttggaactatgcagaagcctctcaattctgtgtggtcaaattctacaccgatgatgatgatgaaccctgttgctgttgatg |
54456952 |
T |
|
| Q |
108 |
cttcacaaccacctgaaatcaaacattttccacagaccagtggcaaggacaaagttattctattggtcagtttcgtaactttttctattctcttctc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54456953 |
cttcacaaccacctgaaatcaaacattttccacagaccagtgacaaggacaaagttattctattggtcagtttcgtaactttttctattctcttctc |
54457049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 8 - 77
Target Start/End: Original strand, 54056532 - 54056601
Alignment:
| Q |
8 |
cttgcaatggagggggcgtttggaactatgcagaagcctctcaattctgtgtggtcaaattctacaccga |
77 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||| | ||||||||||||||||||| |
|
|
| T |
54056532 |
cttgcaatggagggggcgtttggaaccatgcagaggcctctcaattctctatggtcaaattctacaccga |
54056601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 142 - 203
Target Start/End: Original strand, 54056600 - 54056661
Alignment:
| Q |
142 |
gaccagtggcaaggacaaagttattctattggtcagtttcgtaactttttctattctcttct |
203 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||| | || ||||||| ||| |||| |
|
|
| T |
54056600 |
gacctgtgacaaggacaaagttattctattggtcagtttcattacgttttctactcttttct |
54056661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 151 - 203
Target Start/End: Complemental strand, 15039809 - 15039756
Alignment:
| Q |
151 |
caaggacaaagttattctattggtca-gtttcgtaactttttctattctcttct |
203 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||| ||||||||||||||||||||| |
|
|
| T |
15039809 |
caaggacaaaattattctattggtaaagtttcataactttttctattctcttct |
15039756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University