View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4966_high_9 (Length: 269)
Name: NF4966_high_9
Description: NF4966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4966_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 3 - 144
Target Start/End: Complemental strand, 51823480 - 51823339
Alignment:
| Q |
3 |
actaactaactttattgctttctatacttctttatatagtacaggtgatcaaaggcccaattacattttaggttaattaccagaatattgaattactcta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51823480 |
actaactaactttattgctttctatacttctttatatagtacaggtgatcaaaggctcaagtacattttaggttaattaccagaatattgaattactcta |
51823381 |
T |
 |
| Q |
103 |
ctaacattagagaatgaaatactttcataattgcaactgaac |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51823380 |
ctaacattagagaatgaaatactttcataattgcaactgaac |
51823339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University