View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4966_low_10 (Length: 269)

Name: NF4966_low_10
Description: NF4966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4966_low_10
NF4966_low_10
[»] chr4 (1 HSPs)
chr4 (3-144)||(51823339-51823480)


Alignment Details
Target: chr4 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 3 - 144
Target Start/End: Complemental strand, 51823480 - 51823339
Alignment:
3 actaactaactttattgctttctatacttctttatatagtacaggtgatcaaaggcccaattacattttaggttaattaccagaatattgaattactcta 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||    
51823480 actaactaactttattgctttctatacttctttatatagtacaggtgatcaaaggctcaagtacattttaggttaattaccagaatattgaattactcta 51823381  T
103 ctaacattagagaatgaaatactttcataattgcaactgaac 144  Q
    ||||||||||||||||||||||||||||||||||||||||||    
51823380 ctaacattagagaatgaaatactttcataattgcaactgaac 51823339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University