View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4966_low_7 (Length: 371)
Name: NF4966_low_7
Description: NF4966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4966_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 6e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 16 - 198
Target Start/End: Complemental strand, 51809669 - 51809487
Alignment:
| Q |
16 |
ggagtagcatcttaattaggattcaattgattctgaacttcaattatttcaagactagggaaaatggagaggtaaacattaggcatatttggatttggat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51809669 |
ggagtagcatcttaattaggattcaattgattctgaacttcaattatttcaagactagggaaaatggagaggtaaacattaggcatatttggatttggat |
51809570 |
T |
 |
| Q |
116 |
ttttgttgcaaatatgtgtttggatacaaaagtacatttatcctaaaagtgttctcacggtaaagttgacaaagattgataac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51809569 |
ttttgttgcaaatatgtgtttggatacaaaagtacatttatcctaaaagtgttctcacggtaaagttgacaaagattgataac |
51809487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 292 - 361
Target Start/End: Complemental strand, 51809392 - 51809323
Alignment:
| Q |
292 |
gagatggaaaatgtcctcgacttttacatatcaattcaatatccctccgacttcaattattcatctcatt |
361 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||| |||||||||||||||||| ||||||| |
|
|
| T |
51809392 |
gagatggaaaatgtcctcaacttttacatatcaattcgatatctctccgacttcaattattcttctcatt |
51809323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University