View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4968-Insertion-4 (Length: 209)
Name: NF4968-Insertion-4
Description: NF4968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4968-Insertion-4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 8e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 10 - 126
Target Start/End: Original strand, 8057582 - 8057698
Alignment:
| Q |
10 |
gtgtaattctcattgttaaaatttggttgtaattattcttttttggtattcaattggtcaattagttatgactatctagattagatgttaattattttgg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8057582 |
gtgtaattctcattgttaaaatttggttgtaattattcttttttggtattcaattggtcaattagttatgactatctagattagatgttaattattttgg |
8057681 |
T |
|
| Q |
110 |
ccactgaacattgtttt |
126 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
8057682 |
ccactgaacattgtttt |
8057698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 127 - 209
Target Start/End: Original strand, 8057729 - 8057811
Alignment:
| Q |
127 |
atgtcataataatctggtgttccactgaaagataagtaaagtctgaccaaagattgtttcagttaagattcgaaatcaaagtt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8057729 |
atgtcataataatctggtgttccactgaaagataagtaaagtctgaccaaagattgtttcagttaagattcgaaatcaaagtt |
8057811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University