View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4968_low_9 (Length: 392)
Name: NF4968_low_9
Description: NF4968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4968_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 1 - 358
Target Start/End: Complemental strand, 52386024 - 52385667
Alignment:
| Q |
1 |
atgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaattattcatactctgtatgttgctgttcacatatgcctttcccgcttcatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52386024 |
atgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaattattcatactctgtatgttgctgttcacatatgcctttcccgcttcatct |
52385925 |
T |
 |
| Q |
101 |
ttctcttcttcctctttggttcggtgtatgttgtggattgaccccttcttccttgttgattgggaatgggaacctgccacatgcattgttgctcctctgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52385924 |
ttctcttcttcctctttggttcggtgtatgttgtggattgaccccttcttccttgttgattgggaatgggaacctgccacatgcattgttgctcctctgt |
52385825 |
T |
 |
| Q |
201 |
tgtcgcccgccagagttaccacactgactgttttgtcatctgtcggaagctgtgttgctgttgaagtgctcaccgtggctactttattagtaagatttgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52385824 |
tgtcgcccgccagagttaccacactgactgttttgtcatctgtcggaagctgtgttgctgttgatgtgctcaccttggctactttattagtaagatttgt |
52385725 |
T |
 |
| Q |
301 |
tacatcatccttcatagtactattttgcatggtaactggatctgcaactaattggatg |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52385724 |
tacatcatccttcatagtactattttgcatggtaattggatctgcaactaattggatg |
52385667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 84
Target Start/End: Complemental strand, 7087895 - 7087813
Alignment:
| Q |
2 |
tgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaattattcatactctgtatgttgctgttcacatatgc |
84 |
Q |
| |
|
||||| || ||||||||| |||| |||||||| || | ||| | ||||||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
7087895 |
tgaactccagggtctctttcattgattgaaccatgaaacatgagtgaattattgatactttgtatgttgctgttaacatatgc |
7087813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University