View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4969_high_8 (Length: 232)
Name: NF4969_high_8
Description: NF4969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4969_high_8 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 232
Target Start/End: Original strand, 45361982 - 45362195
Alignment:
| Q |
19 |
tttgactatttcactatgcaatggcctgtgagtgtttttctccnnnnnnnnnntcaaagaatgaaacaagttataaattttagcaagtcagatagttaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45361982 |
tttgactatttcactatgcaatggcctgtgagtgtttttctccaaaaaaaaaatcaaagaatgaaacaagttataaattttagcaagtcagatagttaaa |
45362081 |
T |
 |
| Q |
119 |
taaaagttataaatcttggtttttctttcaagcaggttgtgtttcgataattgatggagcaataatgaaaaaagttattataatattagtttgaaaatat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45362082 |
taaaagttataaatcttggtttttctttcaagcaggttgtgtttcgataattgatggagcaataatgaaaaaagttattataatattagtttgaaaatat |
45362181 |
T |
 |
| Q |
219 |
gtgatcatttatgt |
232 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45362182 |
gtgatcatttatgt |
45362195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 132 - 188
Target Start/End: Complemental strand, 39211956 - 39211900
Alignment:
| Q |
132 |
tcttggtttttctttcaagcaggttgtgtttcgataattgatggagcaataatgaaa |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
39211956 |
tcttggtttttctttcaagcaggttgtgtttcgataattaatggaacaataatgaaa |
39211900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 132 - 188
Target Start/End: Complemental strand, 6863558 - 6863502
Alignment:
| Q |
132 |
tcttggtttttctttcaagcaggttgtgtttcgataattgatggagcaataatgaaa |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| || |||||||||||||| |
|
|
| T |
6863558 |
tcttggtttttctttcaagcaggttgtgttttgataattaatagagcaataatgaaa |
6863502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University