View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4969_low_12 (Length: 203)
Name: NF4969_low_12
Description: NF4969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4969_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 43562302 - 43562116
Alignment:
| Q |
1 |
tagttaactaagtcggttagatgattaatttagattacgttgaaatttacatagaattgaatta-ccatatctttaaacatgtgcctttg-gtgtgacaa |
98 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||| ||||| ||||||||| |
|
|
| T |
43562302 |
tagttaactcagtcggttagatgattaatttagattacgttgaaatttacatagaattgaattaaccataattttaaccatgtgtctttgtgtgtgacaa |
43562203 |
T |
|
| Q |
99 |
gtgtacgaaaaagggtatagatgtatcgtcattattgatatgacaaaatattttctcgtataaaaagcaatttcaccaacactattt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43562202 |
gtgtacgaaaaagggtatagatgtatcgtcattattgatatgacaaaatattttctcgtataaaaagcaatttcaccaacactattt |
43562116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University