View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4970-Insertion-17 (Length: 221)
Name: NF4970-Insertion-17
Description: NF4970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4970-Insertion-17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 8 - 221
Target Start/End: Original strand, 6460654 - 6460870
Alignment:
| Q |
8 |
aacttgataactgaaactgaggatttgagcaacatggatccttcaagagcctttgtcagcaaggttaaacgtttgattgttaaggtacttactcatgatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6460654 |
aacttgataactgaaactgaggatttgagcaacatggatccttcaagagcctttgttaacaaggttaagcgtttgattgttaaggtacttactcatgatt |
6460753 |
T |
|
| Q |
108 |
gcatcaatttctttattttcttagtgttttattaaagactaaacaatcaaatgag---ttttttgtctttgaacaccttgagtgtatcataaatataaaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6460754 |
gcatcaatttctttattttcttagtgttttattaaagactaaacaatcaaatgagtttttttttgtctttgaacaccttgagtgtatcataaatataaaa |
6460853 |
T |
|
| Q |
205 |
gcatcattgaatatata |
221 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
6460854 |
acatcattgaatatata |
6460870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University