View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4970_high_19 (Length: 383)
Name: NF4970_high_19
Description: NF4970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4970_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 18 - 372
Target Start/End: Complemental strand, 29671652 - 29671298
Alignment:
| Q |
18 |
agtatctacaattccaaggtaattggatagaagaaacaaggggaacattgatgctggtggcaactgtaattgccacaatgacttttcaatccgcaataag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29671652 |
agtatctacaattccaaggtaattggatagaagaaacaaggggaacattgatgctggtggcaactgtaattgccacaatgacttttcaatccgcaataag |
29671553 |
T |
 |
| Q |
118 |
tccaccaggtggtgtttggcaagaaaatacacttactggaggactcaattgcactacttatggtttatgtgaagccggcactgcagttttagcttatgcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29671552 |
tccaccaggtggtgtttggcaagaaaatacacttactggaggactcaattgcactacttatggtttatgtgaagccggcactgcagttttagcttatgcc |
29671453 |
T |
 |
| Q |
218 |
tggccacatgaattcataaagttcatgacatacaacaccatttctttcttttggtctctcggtgttgtgcttctccttattagtggattcccccttaaga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29671452 |
tggccacatgaattcataaagttcatgacatacaacaccatttctttcttttggtctctcggtgttgtgcttctccttattagtggattcccccttaaga |
29671353 |
T |
 |
| Q |
318 |
ataaggtcatgatgtgggtcttgacattcgctatgaccgtcgctgtcacattcat |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29671352 |
ataaggtcatgatgtgggtcttgacattcgctatgaccgtcgctgtcacattcat |
29671298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 77 - 148
Target Start/End: Original strand, 39949224 - 39949295
Alignment:
| Q |
77 |
gcaactgtaattgccacaatgacttttcaatccgcaataagtccaccaggtggtgtttggcaagaaaataca |
148 |
Q |
| |
|
||||||||||| || |||||||| |||||||| | ||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
39949224 |
gcaactgtaatcgcaacaatgacatttcaatcagtaataagtccaccaggcggtgtttggcaagaagataca |
39949295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 77 - 148
Target Start/End: Original strand, 39944879 - 39944950
Alignment:
| Q |
77 |
gcaactgtaattgccacaatgacttttcaatccgcaataagtccaccaggtggtgtttggcaagaaaataca |
148 |
Q |
| |
|
|||||||| ||||| || ||||||||||| || | ||| |||||||| || ||||||||||||||| ||||| |
|
|
| T |
39944879 |
gcaactgtgattgcaactatgacttttcagtcagtaattagtccaccgggcggtgtttggcaagaagataca |
39944950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University