View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4970_high_45 (Length: 247)
Name: NF4970_high_45
Description: NF4970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4970_high_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 44685936 - 44685691
Alignment:
| Q |
1 |
catctatgaattccgatcaacttcggctgtcgtcttttaggtctattcgggatcaaaagaaaacatagaaacatgtgaacaggaaattaaatagacagta |
100 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44685936 |
catctatgaattccgatcaacttaggccgtcgtcttttaggtttattcgggatcaaaagaaaacatagaaacatgt-aacaggaaattaaatagacagta |
44685838 |
T |
 |
| Q |
101 |
gtggctgtggtatgtcatccaactaattagagatgacaaaaagcattttagggaggtcagaaccgaaataaagaaatatatga------atacatgaaga |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44685837 |
gtggctgtggtatgtcatccaactaattagagatgaaaaaaagcattttagggaggtcagaaccgaaataaagaaatatatgaacagcgatacatgaaga |
44685738 |
T |
 |
| Q |
195 |
tatttgatgcttttactactattatgacccatctttcaaattctgtg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44685737 |
tatttgatgcttttactactattatgacccatctttcaaattctgtg |
44685691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University