View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4970_high_47 (Length: 244)
Name: NF4970_high_47
Description: NF4970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4970_high_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 46366961 - 46366755
Alignment:
| Q |
1 |
tctatcttcatttcatcacataaaagatgtagtactcctagcagattaaggacaaagatgatgaagactgtggatgatgggcaagaccggttcctttttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46366961 |
tctatcttcatttcatcacataaaagatgtagtactcctagcagattaaggacaaagatgatg----------------ggcaagaccggttcctttttt |
46366878 |
T |
 |
| Q |
101 |
gaacttcgggatttgtttttgcattgtcattgtgaacttgtagtactataaacaaattaaataatgtggatttgtttcacactatggtcgtggttgtgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46366877 |
gaacttcgggatttgtttttgcattgtcattgtgaacttgtagtactataaacaaattaaataatgtggatttgtttcacactatggtcgtggttgtgga |
46366778 |
T |
 |
| Q |
201 |
caaagaaagggcatgtttgagat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
46366777 |
caaagaaagggcatgtttgagat |
46366755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University