View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4970_high_48 (Length: 243)
Name: NF4970_high_48
Description: NF4970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4970_high_48 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 14 - 243
Target Start/End: Original strand, 29671092 - 29671321
Alignment:
| Q |
14 |
ttcttgcaaacacacgtcttaacgtgtgcggtttcaatttggttctcttcttgacccaaaaaacaaaacggagtgtgtgaatcaaaccaacaactaaaag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29671092 |
ttcttgcaaacacacgtcttaacgtgtgcagtttcaatttggttctcttcttgacccaaaaaacaaaacggagtgtgtgaatcaaaccaacaactaaaag |
29671191 |
T |
 |
| Q |
114 |
caatacgccccaagttacaacaacacgtgggtaacgcatgttgtaaacttgctgaataatatgataaggagtgaccaaaccctgagcaaacacgtacgtg |
213 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29671192 |
caaaacgccccaagttacaacaacacgtgggtaacgcatgttgtaaacttgctgaataatatgataaggagtgaccaaaccctgagcaaacacgtacgtg |
29671291 |
T |
 |
| Q |
214 |
agtgccatgaatgtgacagcgacggtcata |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29671292 |
agtgccatgaatgtgacagcgacggtcata |
29671321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University