View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4970_high_51 (Length: 236)
Name: NF4970_high_51
Description: NF4970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4970_high_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 46159297 - 46159074
Alignment:
| Q |
1 |
taataccattggaactggtggatggagcctaagtgtttcagtcaaagctgcatgcaggtactacatctttttcatgctttcttcggttattctagttgca |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46159297 |
taataccattggaattggtggatggagcctgagtgtttcagtcaaagctgcatccaggtactgcatctttttcatgctttcttcggttattctagttgca |
46159198 |
T |
 |
| Q |
101 |
agttcatcagtggttgatccatcttctacttttgttgcctccctaatctcttgagcaattttttcctgaacatgaggatgcttgcagagttggtaaataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46159197 |
agttcatcagtggttgatccatcttctacttttgttgcctccctaatctcttgagcaattttttcctgaacatgaggatgcttgcagagttggtaaataa |
46159098 |
T |
 |
| Q |
201 |
atcaggaaagagtgattgatgttg |
224 |
Q |
| |
|
|||||||||||||||| ||||||| |
|
|
| T |
46159097 |
atcaggaaagagtgatcgatgttg |
46159074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 46166374 - 46166151
Alignment:
| Q |
1 |
taataccattggaactggtggatggagcctaagtgtttcagtcaaagctgcatgcaggtactacatctttttcatgctttcttcggttattctagttgca |
100 |
Q |
| |
|
|||||||| |||||||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||| |||||||||||| |||| ||||| |||| |
|
|
| T |
46166374 |
taataccactggaactggtgggtggagcctgagtgtttcagtcaaagctgcatgcaggtactgcatcttttccatgctttcttcagttaatctagctgca |
46166275 |
T |
 |
| Q |
101 |
agttcatcagtggttgatccatcttctacttttgttgcctccctaatctcttgagcaattttttcctgaacatgaggatgcttgcagagttggtaaataa |
200 |
Q |
| |
|
||||||||| | |||||||||||||||||||| ||||||||| ||||||| || |||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
46166274 |
agttcatcaatagttgatccatcttctactttagttgcctccataatctcctgtgcaattttttcctgaacatgaggatgcttgcaaagttggtaaagaa |
46166175 |
T |
 |
| Q |
201 |
atcaggaaagagtgattgatgttg |
224 |
Q |
| |
|
| |||||||||||||||| ||||| |
|
|
| T |
46166174 |
accaggaaagagtgattgctgttg |
46166151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University