View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4970_low_13 (Length: 463)
Name: NF4970_low_13
Description: NF4970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4970_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 421; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 421; E-Value: 0
Query Start/End: Original strand, 16 - 444
Target Start/End: Original strand, 33306205 - 33306633
Alignment:
| Q |
16 |
tcaacaaccgtttcttcactccaccacctcgcaccacgtggcgtcactctcttctttcttctcgcatttcatcttcaactaattacagttacgacgttat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33306205 |
tcaacaaccgtttcttcactccaccacctcgcaccacgtggcgtcactctcttctttcttctcgcatttcatcttcaactaattacagttacaacgttat |
33306304 |
T |
 |
| Q |
116 |
caccaacaaagacgaacgcttactcgaacaaatcgagaacgataacaacaacaccaacgttgttgcaaactcaacaacaattgcagccattgtaacatcc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33306305 |
caccaacaaagacgaacgcttactcgaacaaatcgagaacgataacaacaacaccaacgttgttgcaaactcaacaacaattgcagccattgtaacatcc |
33306404 |
T |
 |
| Q |
216 |
ctaggcggtcccccagccgccgtcggaatcgttcgcctttcaggtccgcacgcggtgtctatcgcgggtcgagttttccgacccgcaagaaacacgtggc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33306405 |
ctaggcggtcccccagccgccgtcggaatcgttcgcctttcaggtccgcacgcggtgtctatcgcgggtcgagttttccgacccgcgagaaacacgtggc |
33306504 |
T |
 |
| Q |
316 |
ggcctactagtcatgttgttgaatacggtgtcgttttggattccgatggaaatgttgttgacgaggttatagcggtgccgatgttagcaccgaggtcgta |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33306505 |
ggcctactagtcatgttgttgaatacggtgtcgttttggattccgatggaaatgttgttgacgaggttatagcggtgccgatgttagcaccgaggtcgta |
33306604 |
T |
 |
| Q |
416 |
tactcgtgaagatgttgttgaacttcagt |
444 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33306605 |
tactcgtgaagatgttgttgaacttcagt |
33306633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University