View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4970_low_21 (Length: 389)
Name: NF4970_low_21
Description: NF4970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4970_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 94 - 379
Target Start/End: Complemental strand, 23797267 - 23796985
Alignment:
| Q |
94 |
gtttcagtaaactcttaacaatgtgattttcaccatatcagttaattatagacattgatagacagatgggtctaggattattgacttttatacnnnnnnn |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23797267 |
gtttcagtaaactcttaacaatgtgattttcaccctatcagt-aatta--gacattgatagatagatgggtctaggattattgacttttatacttatttt |
23797171 |
T |
 |
| Q |
194 |
ggaccgttctataaaaaacatagacatggggacaccgacacgtatttttaattttcttggctgagctatcaatgaaatttgacatttctaaatatatagt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23797170 |
ggaccgttctataaaaaacatagacatggggacaccgacacgtatttttaattttcttggctgagctatcaatgaaatttgacatttctaaatatatagt |
23797071 |
T |
 |
| Q |
294 |
cttgaactttaaaatagccggctctttgccaccacattagagatgatacaaatgtgtccaatttttaatagcaacacctacctatg |
379 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23797070 |
cttgaactttaaaatagccggctctttgccaccacattagagatgatacaaatgtgtccaatttttaatagtaacacctacctatg |
23796985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University