View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4970_low_25 (Length: 380)

Name: NF4970_low_25
Description: NF4970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4970_low_25
NF4970_low_25
[»] chr7 (2 HSPs)
chr7 (219-369)||(48481809-48481959)
chr7 (15-127)||(48481605-48481717)


Alignment Details
Target: chr7 (Bit Score: 151; Significance: 8e-80; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 219 - 369
Target Start/End: Original strand, 48481809 - 48481959
Alignment:
219 gatatggaaataaagtttaactttagcaaattgagatattaactgacctgtaaatggtgaagtcgttccttaaatgaagaaaacaccccagcatcctatc 318  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48481809 gatatggaaataaagtttaactttagcaaattgagatattaactgacctgtaaatggtgaagtcgttccttaaatgaagaaaacaccccagcatcctatc 48481908  T
319 acaaagcaaaattagaattaagagagttttcgaccaaatgacaaaagttga 369  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
48481909 acaaagcaaaattagaattaagagagttttcgaccaaatgacaaaagttga 48481959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 15 - 127
Target Start/End: Original strand, 48481605 - 48481717
Alignment:
15 ttaagttaatacgaaatgttaccatgtccccttcttgcaaatctctacgagcaaagaggccccacccttgaatagctgattttccaaggcagactctaca 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48481605 ttaagttaatacgaaatgttaccatgtccccttcttgcaaatctctacgagcaaagaggccccacccttgaatagctgattttccaaggcagactctaca 48481704  T
115 attttccgttttc 127  Q
     ||||||||||||    
48481705 gttttccgttttc 48481717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University