View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4970_low_25 (Length: 380)
Name: NF4970_low_25
Description: NF4970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4970_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 8e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 219 - 369
Target Start/End: Original strand, 48481809 - 48481959
Alignment:
| Q |
219 |
gatatggaaataaagtttaactttagcaaattgagatattaactgacctgtaaatggtgaagtcgttccttaaatgaagaaaacaccccagcatcctatc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48481809 |
gatatggaaataaagtttaactttagcaaattgagatattaactgacctgtaaatggtgaagtcgttccttaaatgaagaaaacaccccagcatcctatc |
48481908 |
T |
|
| Q |
319 |
acaaagcaaaattagaattaagagagttttcgaccaaatgacaaaagttga |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48481909 |
acaaagcaaaattagaattaagagagttttcgaccaaatgacaaaagttga |
48481959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 15 - 127
Target Start/End: Original strand, 48481605 - 48481717
Alignment:
| Q |
15 |
ttaagttaatacgaaatgttaccatgtccccttcttgcaaatctctacgagcaaagaggccccacccttgaatagctgattttccaaggcagactctaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48481605 |
ttaagttaatacgaaatgttaccatgtccccttcttgcaaatctctacgagcaaagaggccccacccttgaatagctgattttccaaggcagactctaca |
48481704 |
T |
|
| Q |
115 |
attttccgttttc |
127 |
Q |
| |
|
|||||||||||| |
|
|
| T |
48481705 |
gttttccgttttc |
48481717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University