View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4970_low_33 (Length: 331)
Name: NF4970_low_33
Description: NF4970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4970_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 1 - 312
Target Start/End: Original strand, 6084942 - 6085253
Alignment:
| Q |
1 |
atactgatgtatcattttttatggtctcagcacgaaaagggcgcgctcaaatggttacgttaatcagaaaaatgatctggtgcgcaatgtaagttcgtct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
6084942 |
atactgatgtatcattttttatggtctcagcacgaaaagggcgcgctcaaatggttacgttaatcagaaaaatgagctggtgcgaaatgtaagttcgtct |
6085041 |
T |
|
| Q |
101 |
gttttattccttagtaggaaaatccatttctgctgcaatattgtgttaaggttgtttgtttacatatcctgcaggaatgggagataacagctgcttcaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6085042 |
gttttattccttagtaggaaaatccatttctgctgcaatattgtgttaaggttgtttgtttacatatcctgcaggaatgggagataacagctgcttcaga |
6085141 |
T |
|
| Q |
201 |
gaaattggcagagtgtcaagaaaccatccttaaccttgagaagcagttgaaggcaattgctgcaacaacagatgtgtcaattttcgacaacattattgcc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6085142 |
gaaattggcagagtgtcaagaaaccatccttaaccttgagaagcagttgaaggcaattgctgcaacaacagatgtgtcaattttcaacaacattattgcc |
6085241 |
T |
|
| Q |
301 |
gctcatcgtcgt |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6085242 |
gctcatcgtcgt |
6085253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 166 - 246
Target Start/End: Complemental strand, 39104810 - 39104730
Alignment:
| Q |
166 |
atcctgcaggaatgggagataacagctgcttcagagaaattggcagagtgtcaagaaaccatccttaaccttgagaagcag |
246 |
Q |
| |
|
||||| ||||| | ||||||||| || |||||||| || ||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
39104810 |
atcctacaggacttggagataacggccgcttcagaaaagttggcagagtgtcaagaaaccatccttaatcttgggaagcag |
39104730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University