View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4970_low_40 (Length: 278)
Name: NF4970_low_40
Description: NF4970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4970_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 32 - 274
Target Start/End: Original strand, 30808293 - 30808535
Alignment:
| Q |
32 |
agtcaacgagaatgtgtannnnnnnnaaactcttgaaactttaatctacctaaagcatagttcgataatgtatatgaattattttaaaaacccatttaca |
131 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
30808293 |
agtcaacgagaatgtgtactttttttaaactcttgaaactttaatctacctaaagcatagttcgataatgcatatgaattattttaaaaacacatttaca |
30808392 |
T |
 |
| Q |
132 |
tttacattcaatgcttgttccggaccgacataaaacctaaggtgaatggccccaaaaagttaaggctcatattcctcaggagaaagcactgtgatggtgc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30808393 |
tttacattcaatgcttgttccggaccgacataaaacctaaggtgaatggccccaaaaagttaaggctcatattcctcaggagaaagcactatgatggtgc |
30808492 |
T |
 |
| Q |
232 |
acccaaagtcatgtgtgtatgccgcagagacatctcttacaac |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30808493 |
acccaaagtcatgtgtgtatgccgcagagacatctcttacaac |
30808535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University