View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4970_low_49 (Length: 247)

Name: NF4970_low_49
Description: NF4970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4970_low_49
NF4970_low_49
[»] chr2 (1 HSPs)
chr2 (1-241)||(44685691-44685936)


Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 44685936 - 44685691
Alignment:
1 catctatgaattccgatcaacttcggctgtcgtcttttaggtctattcgggatcaaaagaaaacatagaaacatgtgaacaggaaattaaatagacagta 100  Q
    ||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
44685936 catctatgaattccgatcaacttaggccgtcgtcttttaggtttattcgggatcaaaagaaaacatagaaacatgt-aacaggaaattaaatagacagta 44685838  T
101 gtggctgtggtatgtcatccaactaattagagatgacaaaaagcattttagggaggtcagaaccgaaataaagaaatatatga------atacatgaaga 194  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||      |||||||||||    
44685837 gtggctgtggtatgtcatccaactaattagagatgaaaaaaagcattttagggaggtcagaaccgaaataaagaaatatatgaacagcgatacatgaaga 44685738  T
195 tatttgatgcttttactactattatgacccatctttcaaattctgtg 241  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
44685737 tatttgatgcttttactactattatgacccatctttcaaattctgtg 44685691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University