View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4974-Insertion-11 (Length: 88)
Name: NF4974-Insertion-11
Description: NF4974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4974-Insertion-11 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 2e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 2e-39
Query Start/End: Original strand, 7 - 88
Target Start/End: Original strand, 53146261 - 53146342
Alignment:
| Q |
7 |
acctctttggtgctcatctttcctctgaacattgcagatgcagttaagtatcgaccatgtcgagggtcagcagcacacatca |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53146261 |
acctctttggtgctcatctttcctctgaacattgcagatgcagttaagtatcgaccatgtcgagggtcagcagcacacatca |
53146342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 2e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 6 - 88
Target Start/End: Complemental strand, 34841638 - 34841556
Alignment:
| Q |
6 |
cacctctttggtgctcatctttcctctgaacattgcagatgcagttaagtatcgaccatgtcgagggtcagcagcacacatca |
88 |
Q |
| |
|
||||||||||||||||||||| || |||||||| ||||| ||||| | |||||||||||| | ||| |||||||||||||||| |
|
|
| T |
34841638 |
cacctctttggtgctcatcttacccctgaacatggcagacgcagtgaggtatcgaccatgcctaggatcagcagcacacatca |
34841556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.0000000000004; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.0000000000004
Query Start/End: Original strand, 7 - 88
Target Start/End: Complemental strand, 5532568 - 5532487
Alignment:
| Q |
7 |
acctctttggtgctcatctttcctctgaacattgcagatgcagttaagtatcgaccatgtcgagggtcagcagcacacatca |
88 |
Q |
| |
|
||||| |||||||||||||| ||||| ||||| || || ||||| | |||||| ||||| | |||||||||||||||||||| |
|
|
| T |
5532568 |
acctccttggtgctcatcttgcctctaaacatggctgaagcagtgaggtatcgcccatgcctagggtcagcagcacacatca |
5532487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 88
Target Start/End: Original strand, 5934934 - 5935006
Alignment:
| Q |
16 |
gtgctcatctttcctctgaacattgcagatgcagttaagtatcgaccatgtcgagggtcagcagcacacatca |
88 |
Q |
| |
|
||||||||||| |||||||| || || |||||||| | ||| || || |||| |||||||||||||||||||| |
|
|
| T |
5934934 |
gtgctcatcttgcctctgaagatggctgatgcagtgaggtaccgtccgtgtctagggtcagcagcacacatca |
5935006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 88
Target Start/End: Original strand, 5921468 - 5921546
Alignment:
| Q |
10 |
tctttggtgctcatctttcctctgaacattgcagatgcagttaagtatcgaccatgtcgagggtcagcagcacacatca |
88 |
Q |
| |
|
||||| |||||||| || |||||||| || || |||||||| | |||||| || |||| |||||| ||||||||||||| |
|
|
| T |
5921468 |
tctttagtgctcattttgcctctgaagatggctgatgcagtgaggtatcgtccgtgtctagggtcggcagcacacatca |
5921546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University