View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4974_high_13 (Length: 240)
Name: NF4974_high_13
Description: NF4974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4974_high_13 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 105 - 240
Target Start/End: Original strand, 2553329 - 2553464
Alignment:
| Q |
105 |
taggccaagtaatttatgactattatttttcccaccctatgcccttctcacgcgctctgcnnnnnnntacaaaatagccctttggaaaacaaaatccgga |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||| |||||||||||||||| ||| |
|
|
| T |
2553329 |
taggccaagtaatttatgactattatttttcccaccctatgcccttctcacacgacctgcagaaaaatacaaaatagccttttggaaaacaaaatcagga |
2553428 |
T |
 |
| Q |
205 |
aattcccaatagttttcggattacataatcaggaca |
240 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
2553429 |
aattcccaatagtttttggattacataatccggaca |
2553464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 164
Target Start/End: Original strand, 6940575 - 6940608
Alignment:
| Q |
131 |
ttttcccaccctatgcccttctcacgcgctctgc |
164 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
6940575 |
ttttcccaccctatgcccttctcacgcgcactgc |
6940608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 125 - 159
Target Start/End: Complemental strand, 26087831 - 26087797
Alignment:
| Q |
125 |
tattatttttcccaccctatgcccttctcacgcgc |
159 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26087831 |
tattacttttcccaccctatgcccttctcacgcgc |
26087797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 159
Target Start/End: Original strand, 4064236 - 4064274
Alignment:
| Q |
121 |
tgactattatttttcccaccctatgcccttctcacgcgc |
159 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
4064236 |
tgactattatttttcccaccctatgaccttctcccgcgc |
4064274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 159
Target Start/End: Original strand, 55052128 - 55052166
Alignment:
| Q |
121 |
tgactattatttttcccaccctatgcccttctcacgcgc |
159 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
55052128 |
tgactattatttttcccaccctatgaccttctcccgcgc |
55052166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 114 - 159
Target Start/End: Complemental strand, 11457630 - 11457585
Alignment:
| Q |
114 |
taatttatgactattatttttcccaccctatgcccttctcacgcgc |
159 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
11457630 |
taatttatgactattatttttctcaccctatctacttctcacgcgc |
11457585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University